University of Zurich Zurich Open … · 2010. 11. 29. · Address for reprint requests and other...

University of ZurichZurich Open Repository and Archive

Winterthurerstr. 190

CH-8057 Zurich

http://www.zora.uzh.ch

Year: 2007

Compensatory membrane expression of the V-ATPase B2subunit isoform in renal medullary intercalated cells of

B1-deficient mice

Paunescu, T G; Russo, L M; Da Silva, N; Kovacikova, J; Mohebbi, N; Van Hoek, AN; McKee, M; Wagner, C A; Breton, S; Brown, D

Paunescu, T G; Russo, L M; Da Silva, N; Kovacikova, J; Mohebbi, N; Van Hoek, A N; McKee, M; Wagner, C A;Breton, S; Brown, D (2007). Compensatory membrane expression of the V-ATPase B2 subunit isoform in renalmedullary intercalated cells of B1-deficient mice. American Journal of Physiology. Renal Physiology,293(6):F1915-F1926.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:American Journal of Physiology. Renal Physiology 2007, 293(6):F1915-F1926.

Paunescu, T G; Russo, L M; Da Silva, N; Kovacikova, J; Mohebbi, N; Van Hoek, A N; McKee, M; Wagner, C A;Breton, S; Brown, D (2007). Compensatory membrane expression of the V-ATPase B2 subunit isoform in renalmedullary intercalated cells of B1-deficient mice. American Journal of Physiology. Renal Physiology,293(6):F1915-F1926.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:American Journal of Physiology. Renal Physiology 2007, 293(6):F1915-F1926.

Compensatory membrane expression of the V-ATPase B2subunit isoform in renal medullary intercalated cells of

B1-deficient mice

Abstract

Mice deficient in the ATP6V1B1 ("B1") subunit of the vacuolar proton-pumping ATPase (V-ATPase)maintain body acid-base homeostasis under normal conditions, but not when exposed to an acid load.Here, compensatory mechanisms involving the alternate ATP6V1B2 ("B2") isoform were examined toexplain the persistence of baseline pH regulation in these animals. By immunocytochemistry, the meanpixel intensity of apical B2 immunostaining in medullary A intercalated cells (A-ICs) was twofoldgreater in B1-/- mice than in B1+/+ animals, and B2 was colocalized with other V-ATPase subunits. Nosignificant upregulation of B2 mRNA or protein expression was detected in B1-/- mice compared withwild-type controls. We conclude that increased apical B2 staining is due to relocalization ofB2-containing V-ATPase complexes from the cytosol to the plasma membrane. Recycling ofB2-containing holoenzymes between these domains was confirmed by the intracellular accumulation ofB1-deficient V-ATPases in response to the microtubule-disrupting drug colchicine. V-ATPasemembrane expression is further supported by the presence of "rod-shaped" intramembranous particlesseen by freeze fracture microscopy in apical membranes of normal and B1-deficient A-ICs. IntracellularpH recovery assays show that significant (28-40% of normal) V-ATPase function is preserved inmedullary ICs from B1-/- mice. We conclude that the activity of apical B2-containing V-ATPaseholoenzymes in A-ICs is sufficient to maintain baseline acid-base homeostasis in B1-deficient mice.However, our results show no increase in cell surface V-ATPase activity in response to metabolicacidosis in ICs from these animals, consistent with their inability to appropriately acidify their urineunder these conditions.

doi:10.1152/ajprenal.00160.2007 293:1915-1926, 2007. First published Sep 26, 2007;Am J Physiol Renal Physiol

Breton and Dennis Brown Nilufar Mohebbi, Alfred N. Van Hoek, Mary McKee, Carsten A. Wagner, Sylvie Teodor G. Paunescu, Leileata M. Russo, Nicolas Da Silva, Jana Kovacikova,

You might find this additional information useful...

68 articles, 43 of which you can access free at: This article cites http://ajprenal.physiology.org/cgi/content/full/293/6/F1915#BIBL

2 other HighWire hosted articles: This article has been cited by

[PDF] [Full Text] [Abstract]

, January 1, 2008; 294 (1): F130-F138. Am J Physiol Renal PhysiolT. G. Paunescu, N. Da Silva, L. M. Russo, M. McKee, H. A. J. Lu, S. Breton and D. Brown

Association of soluble adenylyl cyclase with the V-ATPase in renal epithelial cells

[PDF] [Full Text] [Abstract], October 1, 2008; 295 (4): C923-C930. Am J Physiol Cell Physiol

T. G. Paunescu, A. C. Jones, R. Tyszkowski and D. Brown V-ATPase expression in the mouse olfactory epithelium

including high-resolution figures, can be found at: Updated information and services http://ajprenal.physiology.org/cgi/content/full/293/6/F1915

can be found at: AJP - Renal Physiologyabout Additional material and information http://www.the-aps.org/publications/ajprenal

This information is current as of March 19, 2009 .

http://www.the-aps.org/.American Physiological Society. ISSN: 0363-6127, ESSN: 1522-1466. Visit our website at (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by therespective cells and vasculature, as well as to the control of body fluid volume and composition. It is published 12 times a year

publishes original manuscripts on a broad range of subjects relating to the kidney, urinary tract, and theirAJP - Renal Physiology

on March 19, 2009

ajprenal.physiology.orgD

ownloaded from

http://ajprenal.physiology.org/cgi/content/full/293/6/F1915#BIBLhttp://ajpcell.physiology.org/cgi/content/abstract/295/4/C923http://ajpcell.physiology.org/cgi/content/full/295/4/C923http://ajpcell.physiology.org/cgi/reprint/295/4/C923http://ajprenal.physiology.org/cgi/content/abstract/294/1/F130http://ajprenal.physiology.org/cgi/content/full/294/1/F130http://ajprenal.physiology.org/cgi/reprint/294/1/F130http://ajprenal.physiology.org/cgi/content/full/293/6/F1915http://www.the-aps.org/publications/ajprenalhttp://www.the-aps.org/http://ajprenal.physiology.org

Compensatory membrane expression of the V-ATPase B2 subunit isoformin renal medullary intercalated cells of B1-deficient mice

Teodor G. Păunescu,1 Leileata M. Russo,1 Nicolas Da Silva,1 Jana Kovacikova,2 Nilufar Mohebbi,2

Alfred N. Van Hoek,1 Mary McKee,1 Carsten A. Wagner,2 Sylvie Breton,1 and Dennis Brown11Center for Systems Biology, Program in Membrane Biology, and Division of Nephrology, Massachusetts General Hospital,and Harvard Medical School, Boston, Massachusetts; and 2Institute of Physiology and Zurich Center for Integrative HumanPhysiology (ZIHP), University of Zurich, Zurich, Switzerland

Submitted 5 April 2007; accepted in final form 22 September 2007

Păunescu TG, Russo LM, Da Silva N, Kovacikova J, MohebbiN, Van Hoek AN, McKee M, Wagner CA, Breton S, Brown D.Compensatory membrane expression of the V-ATPase B2 subunitisoform in renal medullary intercalated cells of B1-deficient mice.Am J Physiol Renal Physiol 293: F1915–F1926, 2007. First publishedSeptember 26, 2007; doi:10.1152/ajprenal.00160.2007.—Mice defi-cient in the ATP6V1B1 (“B1”) subunit of the vacuolar proton-pumping ATPase (V-ATPase) maintain body acid-base homeostasisunder normal conditions, but not when exposed to an acid load. Here,compensatory mechanisms involving the alternate ATP6V1B2 (“B2”)isoform were examined to explain the persistence of baseline pHregulation in these animals. By immunocytochemistry, the mean pixelintensity of apical B2 immunostaining in medullary A intercalatedcells (A-ICs) was twofold greater in B1�/� mice than in B1�/�animals, and B2 was colocalized with other V-ATPase subunits. Nosignificant upregulation of B2 mRNA or protein expression wasdetected in B1�/� mice compared with wild-type controls. Weconclude that increased apical B2 staining is due to relocalization ofB2-containing V-ATPase complexes from the cytosol to the plasmamembrane. Recycling of B2-containing holoenzymes between thesedomains was confirmed by the intracellular accumulation of B1-deficient V-ATPases in response to the microtubule-disrupting drugcolchicine. V-ATPase membrane expression is further supported bythe presence of “rod-shaped” intramembranous particles seen byfreeze fracture microscopy in apical membranes of normal and B1-deficient A-ICs. Intracellular pH recovery assays show that significant(28–40% of normal) V-ATPase function is preserved in medullaryICs from B1�/� mice. We conclude that the activity of apicalB2-containing V-ATPase holoenzymes in A-ICs is sufficient to main-tain baseline acid-base homeostasis in B1-deficient mice. However,our results show no increase in cell surface V-ATPase activity inresponse to metabolic acidosis in ICs from these animals, consistentwith their inability to appropriately acidify their urine under theseconditions.

proton pump; immunofluorescence; pH homeostasis; urinary acidifi-cation; Atp6v1b1�/� mice

THE MAIN MEDIATOR OF INTRACELLULAR organelle acidification ineukaryotic cells and of proton (H�) secretion along the distalrenal nephron is the ubiquitous vacuolar proton-pumpingATPase (vacuolar, or V-type, H�-ATPase, or V-ATPase). TheV-ATPase is a complex enzyme, consisting of two largesectors or domains (V0, the transmembrane domain involved inH� translocation, and V1, the cytosolic domain, responsible forhydrolyzing ATP), which together contain at least 13 distinct

subunits (8, 11, 27, 36, 64). A number of V-ATPase subunitsare known to be encoded by different genes and are expressed inmammalian tissues as multiple distinct isoforms. Certain subunitisoforms exhibit a remarkable specificity in terms of tissue and/orcell type expression, and in some cases even with respect to theirsubcellular localization (31, 33, 46, 52, 54, 59, 60).

The V1 cytosolic sector, which constitutes the catalyticdomain of the enzyme, is composed of eight subunits, includ-ing three copies of the 70-kDa “A” subunit and three copies ofthe 56-kDa “B” subunit, both believed to be involved in ATPbinding (28, 68). This latter V-ATPase subunit occurs as twohighly homologous isoforms (sharing 83% identity in theiramino acid sequences in the mouse) encoded, respectively, bytwo different genes, ATP6V1B1 (or “B1”, initially referred toas the “kidney” isoform), encoded by Atp6v1b1, and ATP6V1B2(or “B2”, originally described as the “brain” isoform), encodedby Atp6v1b2 (7, 9, 26, 38, 58). Mutations in two of the 22genes currently known to encode for V-ATPase subunits werefound to cause autosomal recessive forms of distal renaltubular acidosis (dRTA, or type I RTA), also often associatedwith sensorineural hearing loss. These two genes are Atp6v1b1and Atp6v0a4, which encodes the transmembrane “a” subunitisoform ATP6V0A4, or “a4” (34, 55, 57). dRTA is a geneticdisease characterized by impaired H� secretion by the distalrenal nephron, leading to metabolic acidosis, hypokalemia,nephrocalcinosis, bone disease, and growth retardation (6).

To investigate the physiological mechanisms of dRTA,B1�/� mice (deficient in the B1 subunit of the V-ATPase)were engineered as a mouse model for the study of this humandisease (25). Interestingly, unlike human dRTA patients (35),B1�/� mice fed a normal diet were found to develop nor-mally, without any phenotype of metabolic acidosis, nephro-calcinosis, or inner ear and hearing abnormalities (24, 25). Wealso reported that the apical membrane expression of the B2isoform was significantly augmented in proton-secreting col-lecting duct (CD) A-type intercalated cells (A-ICs) of B1�/�mice, especially in the inner medulla and in the inner stripe ofthe outer medulla (25). Taken together, these data led to thehypothesis that, under these conditions, B2-containingV-ATPases could be involved in H� transport across the apicalplasma membrane and, thus, compensate for the absence of theB1 isoform. However, when B1�/� mice were challengedwith an acid load (by administering NH4Cl in their drinkingwater), they developed a severe systemic acidosis and their

Address for reprint requests and other correspondence: T. G. Păunescu,Program in Membrane Biology and Div. of Nephrology, Massachusetts Gen-eral Hospital, 185 Cambridge St., CPZN 8150, Boston, MA 02114 (e-mail:[email protected]).

The costs of publication of this article were defrayed in part by the paymentof page charges. The article must therefore be hereby marked “advertisement”in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Am J Physiol Renal Physiol 293: F1915–F1926, 2007.First published September 26, 2007; doi:10.1152/ajprenal.00160.2007.

0363-6127/07 $8.00 Copyright © 2007 the American Physiological Societyhttp://www.ajprenal.org F1915

on March 19, 2009


ownloaded from

http://ajprenal.physiology.org

urine pH was found to be inappropriately alkaline. Functionaldata showing no concanamycin-inhibitable, i.e., no V-ATPase-mediated, H� extrusion from cortical collecting duct (CCD)ICs of B1�/� mice also suggested that V-ATPases containingthe B2 subunit isoform may be capable of compensating for theabsence of B1 under some but not all circumstances (25).

Consequently, we set out to investigate these apparentlycontradictory findings comprehensively and to elucidate whether(and, if so, how) apical V-ATPase function in maintainingbody acid-base homeostasis can be preserved in mice devoid ofthe V-ATPase B1 subunit isoform. In particular, we aimed todetermine whether the presumed compensatory mechanisminvolves the alternate 56-kDa B2 isoform. Given the absenceof V-ATPase-mediated H� secretion found in CCD ICs ofB1�/� mice, this study was focused on V-ATPase B2 subunitexpression and subcellular distribution, and V-ATPase func-tion in A-ICs of medullary CDs in mice deficient in theV-ATPase B1 subunit isoform.

MATERIALS AND METHODS

Antibodies. Three affinity-purified polyclonal antibodies were used.They were raised against synthetic peptides corresponding to the 10carboxy-terminal amino acids of ATP6V1A (the V-ATPase 70-kDa Asubunit), ATP6V1B1 (the V-ATPase 56-kDa B1 subunit isoform),and ATP6V1B2 (the B2 isoform), respectively, as previously de-scribed (30, 45). The rabbit anti-A and anti-B1 polyclonal antibodieswere characterized previously (13, 30, 46). The affinity-purifiedchicken anti-B2 antibody was raised against the same sequence as thepreviously described rabbit anti-B2 antibody (45) and was found tohave the same specificity as this antibody (23).

To identify CD A-ICs, we used an anti-AE1 anion exchangeraffinity-purified rabbit polyclonal antibody (2, 10), kindly provided byDr. Seth Alper (Harvard Medical School and Beth Israel DeaconessMedical Center).

The following affinity-purified secondary antibodies were used:indocarbocyanine (Cy3)-conjugated donkey anti-chicken IgY (H�L)(Jackson ImmunoResearch Laboratories, West Grove, PA) at a finalconcentration of 1.5 �g/ml and FITC-conjugated goat anti-rabbit IgG(H�L) (Jackson ImmunoResearch Laboratories), at a final concentra-tion of 25 �g/ml.

Tissue preparation. Adult male mice (30–35 g), wild-type (C57BL6,Jackson Laboratory, Bar Harbor, ME) and B1-deficient (B1�/�),were housed under standard conditions and maintained on a standarddiet. Generation and breeding of the original B1�/� founders havebeen described elsewhere (25). All animals were genotyped by PCRas described previously (25). Where indicated, mice were challengedwith an acid load by administering 1.5% (280 mM) NH4Cl/1%sucrose in their drinking water for 24 h. All animal studies wereapproved by the Massachusetts General Hospital Subcommittee onResearch Animal Care, in accordance with the National Institutes ofHealth, Department of Agriculture, and AAALAC requirements, or bythe local Swiss Veterinary Authority (Veterinäramt, Zurich, Switzer-land), in accordance with Swiss Animal Welfare Laws.

For immunofluorescence experiments, mice were anesthetized us-ing pentobarbital sodium (50 mg/kg body wt ip, Nembutal, AbbottLaboratories, Abbott Park, IL) and perfused through the left cardiacventricle with PBS (0.9% NaCl in 10 mM phosphate buffer, pH 7.4),followed by paraformaldehyde-lysine-periodate fixative (PLP; 4%paraformaldehyde, 75 mM lysine-HCl, 10 mM sodium periodate, and0.15 M sucrose, in 37.5 mM sodium phosphate), as previouslydescribed (45). Both kidneys were dissected, sliced, and further fixedby immersion in PLP for 4 h at room temperature and subsequentlyovernight at 4°C, then rinsed extensively in PBS, and stored at 4°C inPBS containing 0.02% sodium azide until use. For immunoblotting

and total RNA extraction, kidneys were harvested from anesthetizedmice, snap frozen in liquid nitrogen, and stored at �80°C until use.

Immunofluorescence and confocal microscopy. PLP-fixed kidneyslices prepared as described above were cryoprotected in PBS con-taining 0.9 M sucrose overnight at 4°C and then embedded inTissue-Tek OCT compound 4583 (Sakura Finetek USA, Torrance,CA), mounted on a specimen disk, and frozen at �20°C. Sections (4�m) were cut on a Leica CM3050 S cryostat (Leica Microsystems,Bannockburn, IL), collected onto Superfrost Plus precleaned chargedmicroscope slides (Fisher Scientific, Pittsburgh, PA), air-dried, andstored at 4°C until use.

Sections were rehydrated for 3 � 5 min in PBS and treated with 1%(wt/vol) SDS for 4 min for retrieval of antigenic sites (19). After beingwashed for 3 � 5 min in PBS and incubated for 10 min in 1% (wt/vol)BSA in PBS with 0.02% sodium azide to reduce nonspecific staining,the sections were incubated for 90 min with the primary antibodydiluted in Dako antibody diluent (Dako, Carpinteria, CA) at roomtemperature, as described previously (45). After 3 � 5-min PBSwashes, the secondary antibody was applied for 1 h at room temper-ature and the slides were then rinsed again in PBS for 3 � 5 min. Fordual immunostaining, the above protocol was first carried out usingthe anti-B2 antibody and the corresponding anti-chicken secondaryantibody, and then repeated for the second primary antibody asappropriate, followed by the respective anti-rabbit secondary anti-body. Slides were mounted in Vectashield medium (Vector Labora-tories, Burlingame, CA) for microscopy and image acquisition.

Digital images were acquired as described previously (45) byusing a Nikon Eclipse 800 epifluorescence microscope (NikonInstruments, Melville, NY) equipped with an Orca 100 CCDcamera (Hamamatsu, Bridgewater, NJ). Confocal laser-scanningmicroscopy imaging was performed on a Radiance 2000 confocalmicroscopy system (Carl Zeiss MicroImaging, Thornwood, NY)using LaserSharp 2000 version 4.1 software. Epifluorescence andconfocal images were analyzed using IPLab version 3.2.4 image-processing software (Scanalytics, Fairfax, VA) and then importedinto and printed from Adobe Photoshop version 6.0 image-editingsoftware (Adobe Systems, San Jose, CA).

Quantification of mean pixel intensity of apical B2 immunostaining.Sections from four B1�/� and four B1�/� mice were immuno-stained concurrently and under identical conditions, and all digitalimages were acquired using the same exposure parameters, includingno processing, same exposure time (38 ms), and same image size. Thisexposure time was selected to ensure maximal intensity while pre-venting signal saturation. Basolateral staining for the AE1 anionexchanger was used to identify CD A-ICs. Cells for which thenucleus, the apical membrane, and/or the lumen of the tubule were notclearly visible due to the section cut were excluded from the analysis.The segmentation function in the IPLab software was used to selectthe areas corresponding to the B2-associated fluorescence in the apicalregion of the A-ICs. The mean pixel intensity (MPI) of every sucharea was measured, and these data were imported into Microsoft Excelversion 10 (Microsoft, Redmond, WA) for further statistical analysis.The final calculation included an average of 83 inner medullarycollecting duct (IMCD) A-ICs per wild-type mouse and 99 IMCDA-ICs per B1-deficient mouse, with no fewer than 50 cells being takeninto account for any given animal. Summary data are expressed foreach group as means � SD.

Immunogold electron microscopy. Small pieces of PLP-fixedmouse kidney (�1 mm3) from the inner stripe (IS) of the outermedulla (OM) were cryoprotected in PBS containing 2.3 M sucrose.Ultrathin cryosections were cut on a Leica EM FCS (Leica Micro-systems) at �80°C and collected onto formvar-coated gold grids.Sections were incubated on drops of anti-B2 antibody diluted in Dakoantibody diluent for 2 h at room temperature. After being rinsed inPBS, the grids were incubated on drops of goat anti-chicken IgGsecondary antibody coupled to 10 nm gold particles (Ted Pella,Redding, CA) for 1 h at room temperature. The grids were subse-

F1916 B2 V-ATPase MEMBRANE EXPRESSION IN B1�/� MOUSE KIDNEY

AJP-Renal Physiol • VOL 293 • DECEMBER 2007 • www.ajprenal.org

on March 19, 2009


ownloaded from


quently rinsed in distilled water, stained on drops of a uranyl acetate/tylose mixture for 10 min on ice, and then collected on loops andallowed to dry, as previously described (45). Sections were examinedin a JEM-1011 transmission electron microscope (JEOL, Tokyo,Japan) at 80 kV, and images acquired using an AMT digital imagingsystem (Advanced Microscopy Techniques, Danvers, MA) were sub-sequently imported into and printed from Adobe Photoshop.

Freeze-fracture electron microscopy. Wild-type and B1-deficientmice were anesthetized as described above and perfused through theleft ventricle with PBS, followed by 2.5% glutaraldehyde in 0.1 Msodium cacodylate buffer. Kidneys were removed, and the IS of theOM was rapidly dissected and cut into smaller pieces in the fixative.After a further 4-h fixation at room temperature, tissues were rinsed in0.1 M sodium cacodylate buffer and stored at 4°C until further use.After cryoprotection for at least 1 h in 30% glycerol, tissue pieceswere placed on a copper freeze-fracture support and frozen in freon 22cooled by liquid nitrogen. Freeze-fracture replicas from tissues orcells were produced as previously described (51, 62, 63). Afterremoval from the freeze-fracture device, the replicas were cleaned byimmersion for 2 h in concentrated sodium hypochlorite bleach. Rep-licas were washed for 3 � 5 min with distilled water, collected oncopper EM grids, and examined with a JEM-1011 electron micro-scope. Areas of plasma membranes from 10 A-ICs from B1�/� andB1�/� mice were photographed at a final magnification of�100,000. The number of rod-shaped intramembranous particles(IMPs) was counted on digital images and is expressed as the numberper square micron of membrane surface area.

Protein extraction and immunoblotting. Mouse kidney tissues werecut into smaller pieces and disrupted with a Tenbroeck tissue grinderin 3 ml of homogenization buffer (10 mM Tris�HCl pH 7.4, 160 mMNaCl, 1 mM EGTA, 1 mM EDTA, and Complete protease inhibitorsfrom Roche Applied Science, Indianapolis, IN, containing TritonX-100 at a final concentration of 1% and 0.05% Igepal CA-630).Homogenates were centrifuged for 15 min at 16,200 g, 4°C, and thesupernatant was collected, aliquoted, and stored at �80°C. Theprotein concentration was determined with the bicinchoninic acidprotein assay (Pierce Biotechnology, Rockford, IL) using albumin asa standard. Sixty micrograms of protein were diluted in Laemmlireducing sample buffer, boiled for 5 min, and loaded onto Tris-glycinepolyacrylamide 4–20% gradient gels (Cambrex Bio Science, Rock-land, ME). After SDS-PAGE separation, proteins were transferredonto an Immun-Blot polyvinylidene difluoride membrane (Bio-RadLaboratories, Hercules, CA), and the membrane was blocked andincubated overnight at 4°C with the primary antibody diluted 1:2,000in Tris-buffered saline containing 2.5% milk. The membrane wassubsequently washed and incubated with a secondary antibody con-jugated to horseradish peroxidase for 1 h at room temperature aspreviously described (45). Following four additional washes, antibodybinding was detected with the Western Lightning chemiluminescencereagent (PerkinElmer Life Sciences, Boston, MA). For quantitativeanalysis of protein bands from immunoblotting experiments, digitalimages of the membranes were acquired using the EpiChemi3 imagingsystem (UVP, Upland, CA) and analyzed using LabWorks 4.6 soft-ware (UVP).

Total RNA extraction, reverse transcription, and PCR. Total RNAwas isolated from kidneys using the RNeasy Midi kit (Qiagen,Valencia, CA) per the manufacturer’s specifications. The RNA puri-fication included an on-column removal of genomic DNA contami-nation using the RNase-free DNase set (Qiagen). The amount ofextracted RNA was quantified by spectrometry. Extracted RNA wasreverse transcribed (RT) and conventional and quantitative real-timePCR (qRT-PCR) were performed with RT products as templates forup to 40 cycles as previously described (23, 32). qRT-PCR wasperformed using the SYBR Green PCR Master Mix (Applied Biosys-tems, Foster City, CA) and the 7300 Real Time PCR System (AppliedBiosystems). The oligonucleotide primers designed to amplify shortsequences of the mouse Atp6v1b2 and Gapd (encoding for GAPDH)

were as follows: cgaactgtttatgagactttggacatt (Atp6v1b2 forwardprimer), ggtgctctgagggattctcttc (Atp6v1b2 reverse primer), tgagcaa-gagaggccctatcc (Gapd forward primer), and ccctaggcccctcctgttat (Gapdreverse primer) (Sigma-Genosys, The Woodlands, TX). Each qRT-PCR reaction was performed in triplicate. Products were also analyzedby electrophoresis on a 2% agarose gel containing GelStar stain(Cambrex Bio Science). The amplicon sizes are 87 (Atp6v1b2) and 98bp (Gapd).

Intracellular pH measurements. Outer medullary collecting ducts(OMCDs) and the initial part of IMCDs were isolated from control oracid-loaded mouse kidneys and transferred onto glass coverslips asdescribed previously (65, 66).

Coverslips were transferred to a thermostatically controlled perfu-sion chamber (at a flow rate of �3 ml/min) maintained at 37°C on aZeiss Axiovert 200 inverted microscope equipped with a video im-aging system (Visitron, Munich, Germany). The isolated tubules wereincubated in a HEPES-buffered Ringer solution containing the pH-sensitive dye BCECF-AM (10 �M, Invitrogen-Molecular Probes,Eugene, OR) for 20 min and were washed to remove all non dees-terified dye. Intracellular pH (pHi) was monitored by alternatelyexciting the dye with a 10-�m-diameter spot of light at 495 and 440nm while monitoring the emission at 532 nm with a video imagingsystem. Each experiment was calibrated for pHi using the nigericin/high-K� method, and the obtained ratios were converted to pHi asdescribed previously (61, 65, 66). All experiments were performed inthe nominal absence of bicarbonate. The initial solution was aHEPES-buffered Ringer solution (in mM: 125 NaCl, 3 KCl, 1 CaCl2,1.2 MgSO4, 2 KH2PO4, 32.2 HEPES, pH 7.4). Cells were acidifiedusing the NH4Cl (20 mM) prepulse technique and washed with aNa�-free solution (Na� was replaced by equimolar concentrations ofN-methyl-D-glucamine). The rate of V-ATPase activity was deter-mined as the concanamycin-sensitive pHi alkalinization rate in theabsence of Na�. Rates were calculated over the same range of pHi(6.55–6.75) for all cells studied. All chemicals used for pHi measure-ments were from Sigma-Aldrich (St. Louis, MO) and Calbiochem(Darmstadt, Germany).

RESULTS

Subcellular localization of B2 V-ATPase in renal CD ICs.The novel anti-ATP6V1B2 (V-ATPase B2 subunit isoform)antibody raised in chicken allowed us to perform for the firsttime a dual immunostaining experiment for both 56-kDa Bisoforms in the mouse kidney. As previously published formouse and other species by us (39, 45) and others (26, 41, 47),ATP6V1B1 (B1) is expressed in the renal CD at high levels inall ICs. B1 localizes to the apical plasma membrane andsubapical domain in A-ICs, and in some cases also assumes, atlower levels, a more diffuse staining pattern. In B-ICs, B1expression is often localized to the basolateral plasma mem-brane and, at lower levels, throughout the cytosol, and some-times even to the apical/subapical domain in a bipolar stainingpattern (Fig. 1), as previously described (15, 17). On the otherhand, the B2 isoform tends to assume a less polarized local-ization, especially in the CCDs, although even here, but inparticular in the medullary CD A-ICs, the B2 levels appear tobe more elevated in the region between the apical membraneand the nucleus, as previously shown (45). Accordingly, thisregion is characterized by the highest degree of coexpression ofthe two isoforms, while the basolateral plasma membranestains predominantly for B1 (in B-ICs). The cytosol appears tocontain significantly more B2 than B1, which is to be expectedgiven the well-known B2 presence on the membranes ofintracellular organelles (18, 45, 64).

F1917B2 V-ATPase MEMBRANE EXPRESSION IN B1�/� MOUSE KIDNEY


on March 19, 2009


ownloaded from


In the B1-deficient mouse kidney, and particularly in theOMCD and IMCD A-ICs of B1�/� mice, B2 localization isconsiderably more polarized (Fig. 2). A-ICs were clearly iden-tified here by double staining with an anti-AE1 antibody,which stains basolateral membranes of this cell subtype, butnot B-ICs, nor principal cells of the CD. As previously shownfor IMCD A-ICs (25), in numerous OMCD A-ICs B2 alsolocalizes significantly more to the apical plasma membrane,where it exhibits a thin line of bright staining.

Immunogold electron microscopy was used to support theimmunohistochemical data presented above by confirming thatthe V-ATPase B2 subunit isoform localizes to the apicalplasma membrane of B1�/� mouse CD A-ICs. In the repre-sentative example shown here of a CD A-IC from the IS of theOM (Fig. 3), immunoelectron microscopy demonstrates thatthe B2 subunit isoform can be located on the apical membrane,besides being expressed in the subapical region.

To ensure that the B2 isoform localized to the A-IC apicalmembrane in B1�/� mice is incorporated into functionalV-ATPase holoenzymes, we performed dual immunostainingexperiments with other V-ATPase subunits, such as ATP6V1A(the 70-kDa A subunit) and ATP6V1E1, the ubiquitous 31-kDa“E1” subunit isoform, formerly known as ATP6E2 (31). Bothsubunits are part of the cytosolic V1 domain of the enzyme andwere chosen because A is the V-ATPase subunit involved in

the closest interaction with B (as they form an A3B3 hexamer,a subdomain of V1), while E1 is thought to play an essentialrole in the V0-V1 assembly (3) and moreover was previouslyshown to relocate from the cytosolic to the apical membranedomain in response to either chronic acidosis (5) or chroniccarbonic anhydrase inhibition by acetazolamide (4, 45). Wefound B2 V-ATPase to colocalize in a tight apical band inB1�/� mouse medullary CD A-ICs with both A (Fig. 4) andE1 subunits (not shown; see Ref. 25 for the IM).

Quantitative B2 V-ATPase immunofluorescence in IMCD ofwild-type and B1�/� mice. The B2 immunofluorescence re-sults in wild-type and B1-deficient mouse medullary CDspresented above (Fig. 2) suggest that, in the absence of the56-kDa B1 isoform, the alternate B2 subunit isoform relocatesto a large extent from a subapical and cytosolic location to theapical membrane domain. To test this hypothesis, we per-formed measurements of the MPI of the B2-associated immu-nostaining in IMCD A-ICs of B1�/� and B1�/� mice.

To perform the MPI quantification, IMCD A-ICs werepositively identified in both groups of animals by doublestaining with an anti-AE1 antibody (Fig. 5, A and B). Grayscaleimages of the B2 immunostaining taken with the same set ofexposure parameters (Fig. 5, C and D) were used for thequantification, and the areas corresponding to B2 immunoflu-orescence in the apical region of these cells were selected using

Fig. 1. Dual immunofluorescence staining for the V-ATPase B1 (green) and B2 (red) subunit isoforms in wild-type mouse kidney cortex (CO; A–C), inner stripe(IS) of the outer medulla (D–F), and inner medulla (IM; G–I). The B1 subunit is present in all collecting duct intercalated cells (ICs) in the cortex (A), IS (D),and IM (F), and also in distal convoluted tubules (DCT; A). B2 is coexpressed with B1 in these cells (B), but B2 is the only 56-kDa subunit isoform detectedin proximal tubules (PT), as additionally shown in the merged image (C). B2 is also expressed at lower levels in principal cells of the collecting duct in the cortex,IS (E), and IM (H) in the absence of any detectable B1 expression. In the ICs of the medullary collecting duct, B2 is localized in the apical/subapical membranedomain and also diffusely throughout the cytosol, as illustrated by the higher magnification images of IS (E and F) and IM collecting ducts (H and I). Bars �10 �m.



on March 19, 2009


ownloaded from


the segmentation function in the IPLab software (Fig. 5, E–H).The immunostained areas are relatively large in wild-typeanimals, frequently covering a substantial part of the regionbetween the apical membrane and the cell nucleus (Fig. 5E),while the apical staining in B1�/� mice is brighter, althoughrestricted to a very narrow band (Fig. 5G).

Apical MPI values were determined for an average of 83cells per B1�/� mouse and 99 cells per B1�/� mouse. TheseMPI values were averaged for each of the four animals in everygroup, and the mean MPI per group was 925 � 88 for B1�/�mice and 1,860 � 127 for B1�/� mice (Fig. 6). StatisticalANOVA and t-test analyses were performed and demonstratedthat the differences between the two groups of animals werestatistically significant. When the MPI value set from any ofthe four B1-deficient animals is compared with the MPI values

from any of the four wild-type mice, the difference was highlysignificant (P � 0.001).

As indicated above (Figs. 2 and 5), in the A-ICs of B1�/�mice B2 immunostaining within the cytosolic phase appears todecrease, while the apical plasma membrane staining intensi-fies significantly. This is confirmed quantitatively not only bythe twofold increase seen in MPI but also by a decrease in themean surface area of the region exhibiting the highest levels ofB2 immunostaining. Surface area of the regions used in theabove MPI calculations was also measured for every cell usingthe IPLab segmentation function and was found to decrease, onaverage, from 344 � 58 squared pixels (px2) in B1�/� miceto 133 � 62 px2 in B1�/� mice (n � 4 for each group) (P �0.0025).

Freeze-fracture analysis of A-IC membranes. It has beendemonstrated previously that plasma membranes and intracel-lular vesicles from proton-secreting cells, including renal ICs,contain a highly characteristic class of IMPs known as “rod-shaped particles” (RSPs) (15, 29, 43, 56). Based on theirappearance in membranes with high V-ATPase content, theyare believed to represent transmembrane domains of the V-ATPase (16). When OMCD A-ICs from B1�/� mice wereexamined by this technique, abundant rod-shaped IMPs werefound associated with their apical plasma membrane domains,as expected. As shown in Fig. 7, similar IMPs were also foundin B1�/� mice, but their density appeared to be reduced.Quantification of freeze-fracture replicas indeed showed adecrease in the rod-shaped IMP content of A-IC membranesfrom B1-deficient mice compared with normal mice, from3,737 � 933 RSPs/�m2 (mean � SD, n � 5 regions from 3A-ICs) in B1�/� mice to 1,950 � 514 RSPs/�m2 in B1�/�mice (n � 7 regions from 4 A-ICs). This decrease was foundto be statistically significant by t-test analysis (P � 0.0016).

Fig. 2. Immunocytochemical localization ofthe B2 V-ATPase (red) in the A-type ICs(A-ICs) of the collecting duct in wild-typeand B1-deficient (B1�/�) mice. A-ICs wereidentified by double staining with an anti-AE1 antibody (green). When B1�/� miceare compared with their wild-type counter-parts, the B2 immunostaining pattern is seento shift from a diffuse cytoplasmic stainingto a polarized localization that appears as athin, bright band of apical membrane stain-ing in the outer stripe (OS; A and B) and ISof the outer medulla (C and D) and in the IM(E and F). Bars � 10 �m.

Fig. 3. Immunogold electron microscopy of an inner medullary collecting ductA-IC from B1-deficient mouse kidney using an anti-B2 V-ATPase antibody.Numerous gold particles are seen localized to the apical plasma membranedomain and to the microvilli (arrows), confirming B2 membrane expression assuggested by the immunofluorescence experiments. Bar � 0.2 �m.



on March 19, 2009


ownloaded from


V-ATPase B2 subunit redistributes to the cytosolic phase incolchicine-treated B1�/� mice. V-ATPases have been shownto recycle rapidly between cytoplasmic vesicles and the cellmembrane in proton-secreting epithelial cells (12, 14, 44, 49,50). Colchicine, an inhibitor of microtubule polymerization,

was previously found to disrupt this recycling (20, 21). CD ICsof both subtypes were shown to respond to colchicine treat-ment by shifting from a polarized V-ATPase distribution to adispersed cytosolic staining pattern (20). We consequentlyexamined the effect of colchicine treatment on B2-containing

Fig. 4. Double immunofluorescence localization of B2 (red) and A (green) subunits of the V-ATPase in the IS of the outer medulla (A and C) and IM (D–F)of B1�/� mouse kidney. In both regions, these 2 subunits are coexpressed at the level of the apical plasma membrane, seen clearly as yellow staining in themerged images (C and F). Bars � 10 �m.

Fig. 5. Quantification of mean pixel intensity of B2 V-ATPase-associated immunofluorescence. IM collecting duct A-ICs from wild-type (A) andB1-deficient mice (B) were identified by staining with an anti-AE1 antibody (green), and B2 immunostaining (red) was quantified from the respectivegrayscale pictures [B1�/� (C) and B1�/� (D)] acquired with identical exposure parameters. For a typical wild-type A-IC (E) designated in A (arrow),the immunostained area was selected (F) using the segmentation function of IPLab software, and the associated MPI was measured. B1-deficient A-ICswere treated identically; shown here is a cell (G) chosen from B (arrow), which exhibits a much narrower yet brighter immunostained region in the apicalmembrane domain (H). Bars � 15 �m.



on March 19, 2009


ownloaded from


V-ATPases in B1�/� mice. Medullary CD A-ICs from B1-deficient mice injected with colchicine (0.5 mg/100 g body wtip) 4 h before perfusion fixation showed no significant differ-ence in B2 distribution compared with untreated B1�/� mice(data not shown). However, when the duration of colchicinetreatment was increased to 17 h, the B2 V-ATPase stainingpattern in most IMCD and ISCD A-ICs shifted drastically fromthe polarized staining described above (Figs. 2, 4, and 5) to adiffuse pattern, with B2 being localized throughout the cyto-plasm (Fig. 8). Some cells continued to display detectableapical membrane staining after colchicine treatment, but eventhese cells also showed significant subapical and/or cytosolicB2 immunofluorescence. This result is similar to that obtainedpreviously in colchicine-treated kidneys from normal rats (20),

thus allowing for a similar conclusion, i.e., that apical targetingof B2-containing V-ATPases in B1�/� mice is affected bymicrotubule disruption and that the B2 subunit recycles be-tween the plasma membrane and an intracellular vesicularpool.

V-ATPase B2 subunit isoform mRNA and protein expressionin wild-type and B1�/� mice. The apical plasma membraneB2 immunostaining increases significantly in B1�/� mice, asindicated by the doubling of the immunofluorescence MPIcompared with the wild-type mouse group (Fig. 6). We furtherinvestigated whether this increase is due only to a relocaliza-tion of B2-containing V-ATPases from the cytosolic compart-ment to the cell membrane, or additionally to an increase in thelevels of B2 mRNA and protein.

Conventional and qRT-PCR analysis performed with RNAisolated from whole kidneys yielded similar Atp6v1b2 mRNAsignals in all samples, whether extracted from B1�/� orB1�/� mouse kidneys (Fig. 9A). Results for Atp6v1b2 mRNAfrom three different qRT-PCR experiments performed in threeanimals from each group show no statistically significantupregulation in B2 mRNA expression induced by the lack ofthe B1 isoform (Fig. 9B).

However, since these findings do not preclude the possibilityof a compensatory increase in B2 at the protein level in B1�/�mice, we also performed immunoblotting experiments for B2in wild-type and B1-deficient mice. We showed previously thatimmunoblotting of total kidney homogenates revealed, as ex-pected, intense B1 expression in B1�/� and B1�/� mice, butno signal in B1�/� mice (25). We now report that there is nodetectable upregulation of B2 expression in B1�/� micecompared with their B1�/� (Fig. 10A) and B1�/� counter-parts (data not shown). The intensity of the chemiluminescencecorresponding to the B2 and actin protein bands from thisimmunoblotting experiment was quantified, and B2 resultswere normalized to their respective actin loading controls andsubsequently to the mean value of the B1�/� group. Normal-

Fig. 6. Mean pixel intensity (MPI) of apical B2 V-ATPase-associated immu-nofluorescence in 4 wild-type (�/�, black bars) and 4 B1�/� (gray bars)mice is shown here as means � SD. The dark gray bar represents the averageof the B1�/� group, 925 � 88 (n � 4). The average MPI of all cells quantifiedfrom the 4 wild-type animals was 924. The open bar represents the average ofthe B1�/� group, 1,860 � 127 (n � 4), representing an approximately 2-foldincrease over the wild-type group. The corresponding average MPI of allA-ICs quantified from B1-deficient mice was 1,868.

Fig. 7. High-resolution freeze-fracture anal-ysis of outer medullary collecting duct(OMCD) A-ICs from B1�/� and B1�/�mouse kidney. OMCD A-ICs from B1�/�mice exhibit abundant rod-shaped intramem-branous particles associated with their apicalmembranes (A), while B1�/� mouse OMCDA-ICs contain similar but fewer such parti-cles (B). To emphasize the difference inrod-shaped particle density, regions indi-cated by arrows in A and B are shown at ahigher magnification in C (wild-type mouse)and D (B1-deficient mouse). Bars � 100 nm.



on March 19, 2009


ownloaded from


ized results show no statistically significant difference be-tween the B1-deficient and the wild-type animals (n � 3 foreach group, Fig. 10B). Quantitative immunoblotting wasperformed three different times, and every experimentyielded similar results. We can thus conclude that the lack of

the B1 subunit isoform does not induce an increase in the B2expression in the kidney at the total mRNA or total proteinlevel, in agreement with results published recently for theepididymis (23). Consequently, the elevation in apical mem-brane B2 immunostaining may not be due to an increase inthe amount of B2 protein.

Fig. 8. Confocal microscopy showing double immunostaining for AE1 (green, A and D) and B2 V-ATPase (red, B and E) of ICs from colchicine-treatedB1-deficient mouse IS of the outer medulla (A–C) and IM (D–F). Compared with the B2 staining seen ordinarily in medullary A-ICs of untreated B1�/� animals(see Figs. 2, 4, and 5), these animals show, in response to colchicine treatment, significantly less membrane-associated B2 staining and more cytosolic diffusestaining. Bars � 15 �m.

Fig. 9. Expression of Atp6v1b2 mRNA in the kidney of wild-type andB1-deficient mice. Total RNA was isolated from B1�/� and B1�/� mousekidney and genomic DNA contamination was removed. Conventional andquantitative real-time (qRT)-PCR analysis was performed and products wereresolved on a 2% agarose gel. Results show similar Atp6v1b2 mRNA signalsin B1�/� and B1�/� mouse kidneys (A). qRT-PCR analysis for Gapd wasperformed as a control. Atp6v1b2 mRNA data from 3 different experimentsperformed on n � 3 animals from each group were normalized to theirrespective Gapd mRNA values and subsequently to the average of the B1�/�group. Results are shown here as means � SE (B). No statistically significantdifference was found at the B2 mRNA level between B1-deficient (gray bar)and wild-type mice (black bar).

Fig. 10. Detection of the V-ATPase B2 subunit in total kidney homogenate byimmunoblotting. Sixty micrograms of B1�/� and B1�/� mouse kidneyhomogenate were subjected to SDS-PAGE and blotted with a chicken anti-B2antibody (A). A specific 56-kDa band of similar intensity is seen in B1�/� andB1�/� animals. Loading control was performed with an anti-actin antibody.The chemiluminescence intensity of the B2 and actin protein bands from A wasquantified, and the normalized results (B) show no statistically significantdifference between B1�/� (gray bar) and B1�/� mice (black bar). Values aremeans � SE; n � 3 for each group.



on March 19, 2009


ownloaded from


V-ATPase activity in medullary CD A-ICs of B1�/� mice.To assess V-ATPase function in wild-type and B1-deficientmice, we measured the rate of recovery of pHi after acutecellular acidification in A-ICs from IMCDs and OMCDs inboth animal groups. For every animal studied, measurementswere performed in the presence and absence of concanamycin(100 nM), and the rate of V-ATPase activity was determined asthe concanamycin-sensitive pHi alkalinization rate. On aver-age, 140 cells were investigated for each experimental condi-tion (B1�/� vs. B1�/� mice, OMCD vs. IMCD, untreatedcontrol vs. concanamycin-treated).

Summary data show that in OMCD A-ICs of B1�/� micethe baseline pHi recovery rate was 0.047 � 0.002 pH units/min(mean � SE, n � 98 cells) and was reduced by concanamycinto 0.024 � 0.001 pH units/min (n � 144 A-ICs), correspond-ing to a fraction of �50% of the proton efflux, i.e., a rate of0.023 � 0.002 pH units/min, being V-ATPase-dependent(Fig. 11). In comparison, measurements in B1�/� mouseA-ICs (control: n � 119 cells and concanamycin-treated: n �225 cells) yielded a V-ATPase-mediated pHi alkalinization rateof 0.009 � 0.001 pH units/min, with a baseline pHi recoveryrate of 0.028 � 0.002 pH units/min, decreasing to 0.019 �0.001 pH units/min in the presence of concanamycin. Weconclude that a significant fraction (40%) of the V-ATPaseactivity in the OMCD A-ICs is preserved despite the absenceof the B1 subunit.

Analyzing the measurements for IMCD A-ICs in a similarway reveals that the V-ATPase-mediated pHi recovery rate was0.019 � 0.003 pH units/min in the wild-type animals (control:n � 153; concanamycin: n � 132 cells), slightly (but notsignificantly) lower than in the OMCD. This was reducedfurther in B1-deficient mice to 0.005 � 0.002 pH units/min(control: n � 153; concanamycin: n � 100 cells). Therefore,V-ATPase function in the apical membrane of IMCD A-ICs inanimals lacking the B1 subunit isoform is decreased to �28%of the level found in wild-type mice. Importantly, the pHirecovery rate in the presence of concanamycin was similar inthe two animal groups: 0.035 � 0.002 pH units/min (wild-type) and 0.033 � 0.002 pH units/min (B1-deficient mice).

Analyses of the four data sets demonstrated that in all casesstudied, the concanamycin treatment induced a statistically

significant reduction in the H�-extrusion rate from A-ICs (P �0.05 for B1�/� IMCD, P � 0.0001 for B1�/� OMCD, andP � 0.0001 for B1�/�, both IMCD and OMCD), thus con-firming the presence of plasma membrane, concanamycin-sensitive V-ATPase activity in OMCD and IMCD A-ICs fromboth wild-type and B1-deficient mice.

We also determined the rate of recovery of pHi in A-ICsfrom OMCDs of acid-loaded B1�/� vs. B1�/� mice. Theoral administration of NH4Cl (280 mM for 24 h) was previ-ously shown to cause a significant reduction in systemic pH inboth wild-type and B1-deficient mice (25). In acid-loadedwild-type mice, concanamycin-sensitive V-ATPase activitywas 0.029 � 0.002 pH units/min (control: n � 40; concana-mycin: n � 44 cells), representing a 26% increase over therate found in unchallenged animals. In contrast, B1-deficientmice showed no stimulation of the V-ATPase activity fol-lowing the acid loading; the V-ATPase-mediated pHi alka-linization rate was 0.005 � 0.002 pH units/min in this group(control: n � 39; concanamycin: n � 36 cells). Similar to thecase of unchallenged animals, there were no statistically sig-nificant differences in the pHi recovery rate in the presence ofconcanamycin following the acid challenge in the two animalgroups. Immunofluorescence localization of B2 V-ATPase inacid-loaded B1�/� mice (data not shown) was indistinguish-able from the pattern seen in unchallenged animals, in which atight apical localization of the B2 subunit was already detect-able (Figs. 2, 4, and 5).

DISCUSSION

Mice lacking the V-ATPase 56-kDa ATP6V1B1 (B1) sub-unit isoform are able to partially compensate for its loss via amechanism that is sufficient to maintain acid-base balance invarious organ systems under baseline conditions (25). In thisstudy, we investigated the role of the alternate 56-kDaATP6V1B2 (B2) isoform in this compensatory mechanism. B2generally assumes a diffuse intracellular localization, althoughin some cells, especially in medullary CD A-ICs, it is moreconcentrated in the apical region, as shown previously (45).This staining pattern is consistent with the B2 isoform beingpresent on intracellular organelles such as endosomes, lyso-somes, and parts of the Golgi/trans-Golgi network, where itplays a “housekeeping” role in acidification processes that areimportant to a variety of cellular functions (27, 40, 42, 47, 64).

However, the B2 isoform is not entirely intracellular and canbe detected on the plasma membrane of various cells, includingcertain renal epithelial cells, indicating that it contributes to H�

secretion under some conditions and in some tissues. Forexample, proximal tubule epithelial cells normally expressapical membrane-associated V-ATPases containing the B2isoform (18, 45, 64) and, in osteoclasts, membrane expressionof V-ATPases containing the B2 and not the B1 isoformmediates H� transport across the ruffled membrane to permitbone resorption (37). We previously described abundant apicalB2 expression in A-ICs from CDs of rats treated withacetazolamide, a condition in which H� secretion by ICsappears to be stimulated to compensate for decreased proximalbicarbonate reabsorption that would otherwise lead to severemetabolic acidosis (45).

More recently, we reported that A-ICs from the B1�/�mouse kidney showed a more apically polarized distribution of

Fig. 11. V-ATPase activity measured as concanamycin-inhibitable intracellu-lar pH (pHi) recovery rate in A-ICs from the outer medulla (OM) and IM ofB1�/� and B1�/� mice is shown here as means � SE. V-ATPase-mediatedpHi recovery rate is maintained in the OM of B1-deficient mice at a levelcorresponding to 40% of the V-ATPase activity in wild-type mice. In IMCDA-ICs of B1�/� mice, V-ATPase function represents �28% of the valuefound in wild-type mice.



on March 19, 2009


ownloaded from


the B2 subunit (25), and we now demonstrate that a significantportion (28–40%) of wild-type plasma membrane V-ATPaseactivity is retained in medullary A-ICs from B1-deficient mice.We propose that this level of V-ATPase activity is sufficient tomaintain normal acid-base levels in B1�/� mice, but that thereduced proton secretory capacity of A-ICs is limiting uponacid loading of the animals, which then develop severe meta-bolic acidosis with acidemia (25). The lack of stimulation ofV-ATPase activity in outer medullary CD A-ICs of B1�/�mice in response to acid loading reported here provides at leasta partial explanation for these findings. Furthermore, it hasrecently been shown that angiotensin II fails to increase pHirecovery in ICs from B1-deficient mice (48). These data,combined with our present findings, could indicate 1) that B2incorporation/activity in the plasma membrane of B1-deficientmice is already at maximum levels and cannot be increased inresponse to further challenges, and/or 2) that increased plasmamembrane incorporation of B2-containing holoenzymes inresponse to physiological stimuli is impaired due to the ab-sence of some as yet unknown trafficking or targeting sequencethat might be present in the B1 isoform. Nevertheless, while itis clear that under normal circumstances most of the H�

secretory activity of ICs is mediated by V-ATPases containingthe B1 subunit, it is also now apparent that this activity can besupplemented in extreme conditions (such as the acetazolamidetreatment of animals) (4, 45) or partially replaced (in B1�/�mice) by V-ATPase holoenzymes that contain B2, as shown inthe present study.

V-ATPase insertion into the apical plasma membrane ofA-ICs from B1-deficient mice is also suggested by the presenceof RSPs on these membranes. RSPs have long been associatedwith the V-ATPase in a variety of cell types (15, 16, 29, 43,56), although whether they actually represent V-ATPase trans-membrane domains has never been definitively proven. Thesimilar appearance of RSPs in both wild-type and B1-deficientmice indicates that their morphology is not related to thepresence of a particular B subunit isoform. This agrees withdata from prior studies that revealed RSPs in IC membranes (inwhich the B1 subunit is predominant) (15, 22, 56) and also inthe osteoclast ruffled membrane, in which the B2 subunit isexpressed (1). However, the number of RSPs in cells fromB1-deficient mice is reduced by 50% compared with wild-typemice. It is possible that this reflects a decrease in the associa-tion of transmembrane V-ATPase subunits into these charac-teristic particles. Indeed, the RSP reduction correlates wellwith the 60% loss of V-ATPase activity measured in OMCDICs in the pHi recovery assay.

Our present data partially address the mechanism by whichisoform replacement may occur. The absence of significantupregulation in B2 expression in the B1�/� mouse kidney ateither the mRNA or the protein level suggests that the increasein apical membrane B2 expression is at least in part due to aredistribution of B2-containing V-ATPases from the cytoplasmto the apical membrane domain. That B2-containing holoen-zymes can recycle between these domains is supported by theintracellular accumulation of B1-deficient V-ATPases in re-sponse to colchicine, which blocks this recycling pathway.These findings are comparable to previously published resultsthat described the relocation of ATP6V1E1 protein (the ubiq-uitous V-ATPase 31-kDa E1 subunit isoform) from the cytosolto the plasma membrane in rat A-ICs in response to chronic

oral acid loading, which occurred in the absence of significantupregulation in mRNA or protein levels even after 14 days oftreatment (5). Another study also reported no increase in B1subunit protein levels in mouse kidney cortex or medulla afterup to 7 days of acid loading (26). The results reported here arealso in very good agreement with our recent data showing acomparable increase in the B2 V-ATPase-associated immuno-staining in the apical pole of clear cells from the caudaepididymis of B1-deficient mice (23). Similarly, this increasecannot be attributed to an upregulation of the B2 isoform at themRNA or protein level. One can thus infer that analogousmechanisms may underline the B2 response to the absence offunctional B1 V-ATPase in proton-secreting renal ICs andepididymal clear cells.

The pHi recovery data presented here indicate that, unlike inICs from the CCD that show no mean pHi recovery in B1�/�mice (25), up to 40% of the V-ATPase activity of OMCDA-ICs is preserved in the absence of the B1 subunit isoform. Inthe inner medulla, pHi recovery of ICs was reduced to 28% ofwild-type values, less than in the outer medulla but still potentiallysignificant enough to contribute to urinary H� secretion. In con-clusion, all the evidence points toward a compensatory mecha-nism in the medullary CD A-ICs of B1�/� mice involving thealternate 56-kDa B2 isoform, which can play a part in transport-ing protons across the apical plasma membrane and, thus, bringan essential contribution to urinary acidification and to themaintenance of acid-base homeostasis in this animal groupunder baseline conditions. The reasons why this mechanismdoes not produce similar results in the ICs of the CCD ofB1-deficient mice are currently incompletely understood.While this disparity may be related, at least in part, to thedifferences in the interstitial environment surrounding the cor-tical and the medullary CD, further investigations will berequired to address this issue.

It should be mentioned that in addition to the V-ATPase(i.e., B2)-mediated pHi recovery, our data indicate thatsodium-, bicarbonate-, and concanamycin-independent trans-port processes may also be involved in the normal and B1�/�mouse CD. However, the activity of concanamycin-indepen-dent proton extrusion mechanisms, possibly including the H�-K�-ATPase, was similar in normal and B1-deficient mice,indicating that no detectable compensatory upregulation oc-curred. The nature of additional non-V-ATPase H� extrusionmechanisms remains to be investigated in future studies.

It has yet to be determined how the B2 subunit can beincorporated into a functional V-ATPase that is targeted to theplasma membrane, and why this mechanism is apparently notsufficient to compensate in humans with dRTA resulting fromB1 subunit mutations. It has been shown that B1 constructsbearing the single amino acid mutations described in dRTApatients do not assemble into functional V-ATPase complexes(67). These mutated B1 subunits impair the plasma membranetrafficking and insertion of the V-ATPase, possibly by com-peting with wild-type holoenzymes for components of thevesicle-targeting machinery. In contrast, the B1-deficientmouse does not express such an abnormal B1 protein that couldalter trafficking of wild-type V-ATPases. In the completeabsence of B1, it is likely that B2 is free to incorporate intoholoenzymes that are targeted to the plasma membrane basedon as yet unidentified targeting sequences in other subunits,possibly the transmembrane a4 subunit (46, 53) with which



on March 19, 2009


ownloaded from


both B1 and B2 can associate (59). Further studies, includingthe generation of mice expressing B1 subunits that replicate thehuman dRTA-inducing mutations will be required to explorethese possibilities.

GRANTS

This study was supported by National Institutes of Health (NIH) GrantsDK-73266 (to T. G. Păunescu), DK-42956 (to D. Brown), DK-38452 (to D.Brown and S. Breton), and HD-40793 (to S. Breton), by Swiss NationalScience Foundation Grant 31-109677/1, and the EU 6th Framework projectEuReGene 005085 (to C. A. Wagner). L. M. Russo is the recipient of anAdvanced Post-doctoral Award from the Juvenile Diabetes Research Founda-tion International.

REFERENCES

1. Akisaka T, Yoshida H, Kogaya Y, Kim S, Yamamoto M, Kataoka K.Membrane modifications in chick osteoclasts revealed by freeze-fracturereplicas. Am J Anat 188: 381–392, 1990.

2. Alper SL, Natale J, Gluck S, Lodish HF, Brown D. Subtypes ofintercalated cells in rat kidney collecting duct defined by antibodiesagainst erythroid band 3 and renal vacuolar H�-ATPase. Proc Natl AcadSci USA 86: 5429–5433, 1989.

3. Arata Y, Baleja JD, Forgac M. Cysteine-directed cross-linking to sub-unit B suggests that subunit E forms part of the peripheral stalk of thevacuolar H�-ATPase. J Biol Chem 277: 3357–3363, 2002.

4. Bagnis C, Marshansky V, Breton S, Brown D. Remodeling the cellularprofile of collecting ducts by chronic carbonic anhydrase inhibition. Am JPhysiol Renal Physiol 280: F437–F448, 2001.

5. Bastani B, Purcell H, Hemken P, Trigg D, Gluck S. Expression anddistribution of renal vacuolar proton-translocating adenosine triphos-phatase in response to chronic acid and alkali loads in the rat. J Clin Invest88: 126–136, 1991.

6. Batlle D, Ghanekar H, Jain S, Mitra A. Hereditary distal renal tubularacidosis: new understandings. Annu Rev Med 52: 471–484, 2001.

7. Bernasconi P, Rausch T, Struve I, Morgan L, Taiz L. An mRNA fromhuman brain encodes an isoform of the B subunit of the vacuolarH�-ATPase. J Biol Chem 265: 17428–17431, 1990.

8. Beyenbach KW, Wieczorek H. The V-type H� ATPase: molecularstructure and function, physiological roles and regulation. J Exp Biol 209:577–589, 2006.

9. Bowman BJ, Allen R, Wechser MA, Bowman EJ. Isolation of genesencoding the Neurospora vacuolar ATPase. Analysis of vma-2 encodingthe 57-kDa polypeptide and comparison to vma-1. J Biol Chem 263:14002–14007, 1988.

10. Breton S, Alper SL, Gluck SL, Sly WS, Barker JE, Brown D.Depletion of intercalated cells from collecting ducts of carbonic anhydraseII-deficient (CAR2 null) mice. Am J Physiol Renal Fluid ElectrolytePhysiol 269: F761–F774, 1995.

11. Breton S, Brown D. New insights into the regulation of V-ATPase-dependent proton secretion. Am J Physiol Renal Physiol 292: F1–F10,2007.

12. Breton S, Nsumu NN, Galli T, Sabolic I, Smith PJ, Brown D. Tetanustoxin-mediated cleavage of cellubrevin inhibits proton secretion in themale reproductive tract. Am J Physiol Renal Physiol 278: F717–F725,2000.

13. Breton S, Wiederhold T, Marshansky V, Nsumu NN, Ramesh V,Brown D. The B1 subunit of the H�ATPase is a PDZ domain-bindingprotein. Colocalization with NHE-RF in renal B-intercalated cells. J BiolChem 275: 18219–18224, 2000.

14. Brown D, Breton S. H�V-ATPase-dependent luminal acidification in thekidney collecting duct and the epididymis/vas deferens: vesicle recyclingand transcytotic pathways. J Exp Biol 203: 137–145, 2000.

15. Brown D, Breton S. Mitochondria-rich, proton-secreting epithelial cells.J Exp Biol 199: 2345–2358, 1996.

16. Brown D, Gluck S, Hartwig J. Structure of the novel membrane-coatingmaterial in proton-secreting epithelial cells and identification as anH�ATPase. J Cell Biol 105: 1637–1648, 1987.

17. Brown D, Hirsch S, Gluck S. An H�-ATPase in opposite plasmamembrane domains in kidney epithelial cell subpopulations. Nature 331:622–624, 1988.

18. Brown D, Hirsch S, Gluck S. Localization of a proton-pumping ATPasein rat kidney. J Clin Invest 82: 2114–2126, 1988.

19. Brown D, Lydon J, McLaughlin M, Stuart-Tilley A, Tyszkowski R,Alper S. Antigen retrieval in cryostat tissue sections and cultured cells bytreatment with sodium dodecyl sulfate (SDS). Histochem Cell Biol 105:261–267, 1996.

20. Brown D, Sabolic I, Gluck S. Colchicine-induced redistribution of protonpumps in kidney epithelial cells. Kidney Int Suppl 33: S79–S83, 1991.

21. Brown D, Smith PJ, Breton S. Role of V-ATPase-rich cells in acidifi-cation of the male reproductive tract. J Exp Biol 200: 257–262, 1997.

22. Brown D, Stow JL. Protein trafficking and polarity in kidney epithelium:from cell biology to physiology. Physiol Rev 76: 245–297, 1996.

23. Da Silva N, Shum WW, El-Annan J, Păunescu TG, McKee M, SmithPJ, Brown D, Breton S. Relocalization of the V-ATPase B2 subunit tothe apical membrane of epididymal clear cells of mice deficient in the B1subunit. Am J Physiol Cell Physiol 293: C199–C210, 2007.

24. Dou H, Finberg K, Cardell EL, Lifton R, Choo D. Mice lacking the B1subunit of H�-ATPase have normal hearing. Hear Res 180: 76–84, 2003.

25. Finberg KE, Wagner CA, Bailey MA, Păunescu TG, Breton S, BrownD, Giebisch G, Geibel JP, Lifton RP. The B1-subunit of the H� ATPaseis required for maximal urinary acidification. Proc Natl Acad Sci USA 102:13616–13621, 2005.

26. Finberg KE, Wagner CA, Stehberger PA, Geibel JP, Lifton RP.Molecular cloning and characterization of Atp6v1b1, the murine vacuolarH�-ATPase B1-subunit. Gene 318: 25–34, 2003.

27. Futai M, Oka T, Sun-Wada G, Moriyama Y, Kanazawa H, Wada Y.Luminal acidification of diverse organelles by V-ATPase in animal cells.J Exp Biol 203: 107–116, 2000.

28. Gruber G, Wieczorek H, Harvey WR, Muller V. Structure-functionrelationships of A-, F- and V-ATPases. J Exp Biol 204: 2597–2605, 2001.

29. Humbert F, Pricam C, Perrelet A, Orci L. Specific plasma membranedifferentiations in the cells of the kidney collecting tubule. J UltrastructRes 52: 13–20, 1975.

30. Hurtado-Lorenzo A, Skinner M, El Annan J, Futai M, Sun-Wada GH,Bourgoin S, Casanova J, Wildeman A, Bechoua S, Ausiello DA,Brown D, Marshansky V. V-ATPase interacts with ARNO and Arf6 inearly endosomes and regulates the protein degradative pathway. Nat CellBiol 8: 124–136, 2006.

31. Imai-Senga Y, Sun-Wada GH, Wada Y, Futai M. A human gene,ATP6E1, encoding a testis-specific isoform of H�-ATPase subunit E.Gene 289: 7–12, 2002.

32. Isnard-Bagnis C, Da Silva N, Beaulieu V, Yu AS, Brown D, Breton S.Detection of ClC-3 and ClC-5 in epididymal epithelium: immunofluores-cence and RT-PCR after LCM. Am J Physiol Cell Physiol 284: C220–C232, 2003.

33. Jouret F, Auzanneau C, Debaix H, Wada GH, Pretto C, Marbaix E,Karet FE, Courtoy PJ, Devuyst O. Ubiquitous and kidney-specificsubunits of vacuolar H�-ATPase are differentially expressed duringnephrogenesis. J Am Soc Nephrol 16: 3235–3246, 2005.

34. Karet FE, Finberg KE, Nelson RD, Nayir A, Mocan H, Sanjad SA,Rodriguez-Soriano J, Santos F, Cremers CW, Di Pietro A, HoffbrandBI, Winiarski J, Bakkaloglu A, Ozen S, Dusunsel R, Goodyer P,Hulton SA, Wu DK, Skvorak AB, Morton CC, Cunningham MJ, JhaV, Lifton RP. Mutations in the gene encoding B1 subunit of H�-ATPasecause renal tubular acidosis with sensorineural deafness. Nat Genet 21:84–90, 1999.

35. Karet FE, Gainza FJ, Gyory AZ, Unwin RJ, Wrong O, Tanner MJ,Nayir A, Alpay H, Santos F, Hulton SA, Bakkaloglu A, Ozen S,Cunningham MJ, di Pietro A, Walker WG, Lifton RP. Mutations in thechloride-bicarbonate exchanger gene AE1 cause autosomal dominant butnot autosomal recessive distal renal tubular acidosis. Proc Natl Acad SciUSA 95: 6337–6342, 1998.

36. Kawasaki-Nishi S, Nishi T, Forgac M. Proton translocation driven byATP hydrolysis in V-ATPases. FEBS Lett 545: 76–85, 2003.

37. Lee BS, Holliday LS, Ojikutu B, Krits I, Gluck SL. Osteoclasts expressthe B2 isoform of vacuolar H�-ATPase intracellularly and on their plasmamembranes. Am J Physiol Cell Physiol 270: C382–C388, 1996.

38. Manolson MF, Ouellette BF, Filion M, Poole RJ. cDNA sequence andhomologies of the “57-kDa” nucleotide-binding subunit of the vacuolarATPase from Arabidopsis. J Biol Chem 263: 17987–17994, 1988.

39. Miller RL, Zhang P, Smith M, Beaulieu V, Păunescu TG, Brown D,Breton S, Nelson RD. V-ATPase B1-subunit promoter drives expressionof EGFP in intercalated cells of kidney, clear cells of epididymis andairway cells of lung in transgenic mice. Am J Physiol Cell Physiol 288:C1134–C1144, 2005.



on March 19, 2009


ownloaded from


40. Nelson N, Harvey WR. Vacuolar and plasma membrane proton-adeno-sinetriphosphatases. Physiol Rev 79: 361–385, 1999.

41. Nelson RD, Guo XL, Masood K, Brown D, Kalkbrenner M, Gluck S.Selectively amplified expression of an isoform of the vacuolar H�-ATPase56-kilodalton subunit in renal intercalated cells. Proc Natl Acad Sci USA89: 3541–3545, 1992.

42. Nishi T, Forgac M. The vacuolar H�-ATPases—nature’s most versatileproton pumps. Nat Rev Mol Cell Biol 3: 94–103, 2002.

43. Orci L, Humbert F, Brown D, Perrelet A. Membrane ultrastructure inurinary tubules. Int Rev Cytol 73: 183–242, 1981.

44. Pastor-Soler N, Beaulieu V, Litvin TN, Da Silva N, Chen Y, Brown D,Buck J, Levin LR, Breton S. Bicarbonate-regulated adenylyl cyclase(sAC) is a sensor that regulates pH-dependent V-ATPase recycling. J BiolChem 278: 49523–49529, 2003.

45. Păunescu TG, Da Silva N, Marshansky V, McKee M, Breton S, BrownD. Expression of the 56-kDa B2 subunit isoform of the vacuolar H�-ATPase in proton-secreting cells of the kidney and epididymis. Am JPhysiol Cell Physiol 287: C149–C162, 2004.

46. Pietrement C, Sun-Wada GH, Da Silva N, McKee M, Marshansky V,Brown D, Futai M, Breton S. Distinct expression patterns of differentsubunit isoforms of the V-ATPase in the rat epididymis. Biol Reprod 74:185–194, 2006.

47. Puopolo K, Kumamoto C, Adachi I, Magner R, Forgac M. Differentialexpression of the “B” subunit of the vacuolar H�-ATPase in bovinetissues. J Biol Chem 267: 3696–3706, 1992.

48. Rothenberger F, Velic A, Stehberger PA, Kovacikova J, Wagner CA.Angiotensin II stimulates vacuolar H�-ATPase activity in renal acid-secretory intercalated cells from the outer medullary collecting duct. J AmSoc Nephrol 18: 2085–2093, 2007.

49. Schwartz GJ, Al-Awqati Q. Carbon dioxide causes exocytosis of vesiclescontaining H� pumps in isolated perfused proximal and collecting tubules.J Clin Invest 75: 1638–1644, 1985.

50. Schwartz GJ, Barasch J, Al-Awqati Q. Plasticity of functional epithelialpolarity. Nature 318: 368–371, 1985.

51. Silberstein C, Bouley R, Huang Y, Fang P, Pastor-Soler N, Brown D,Van Hoek AN. Membrane organization and function of M1 and M23isoforms of aquaporin-4 in epithelial cells. Am J Physiol Renal Physiol287: F501–F511, 2004.

52. Smith AN, Borthwick KJ, Karet FE. Molecular cloning and character-ization of novel tissue-specific isoforms of the human vacuolar H�-ATPase C, G and d subunits, and their evaluation in autosomal recessivedistal renal tubular acidosis. Gene 297: 169–177, 2002.

53. Smith AN, Finberg KE, Wagner CA, Lifton RP, Devonald MA, Su Y,Karet FE. Molecular cloning and characterization of Atp6n1b: a novelfourth murine vacuolar H�-ATPase a-subunit gene. J Biol Chem 276:42382–42388, 2001.

54. Smith AN, Jouret F, Bord S, Borthwick KJ, Al-Lamki RS, WagnerCA, Ireland DC, Cormier-Daire V, Frattini A, Villa A, Kornak U,Devuyst O, Karet FE. Vacuolar H�-ATPase d2 subunit: molecularcharacterization, developmental regulation, and localization to specializedproton pumps in kidney and bone. J Am Soc Nephrol 16: 1245–1256,2005.

55. Smith AN, Skaug J, Choate KA, Nayir A, Bakkaloglu A, Ozen S,Hulton SA, Sanjad SA, Al-Sabban EA, Lifton RP, Scherer SW, KaretFE. Mutations in ATP6N1B, encoding a new kidney vacuolar protonpump 116-kD subunit, cause recessive distal renal tubular acidosis withpreserved hearing. Nat Genet 26: 71–75, 2000.

56. Stetson DL, Wade JB, Giebisch G. Morphologic alterations in the ratmedullary collecting duct following potassium depletion. Kidney Int 17:45–56, 1980.

57. Stover EH, Borthwick KJ, Bavalia C, Eady N, Fritz DM, Rungroj N,Giersch AB, Morton CC, Axon PR, Akil I, Al-Sabban EA, BaguleyDM, Bianca S, Bakkaloglu A, Bircan Z, Chauveau D, Clermont MJ,Guala A, Hulton SA, Kroes H, Li Volti G, Mir S, Mocan H, Nayir A,Ozen S, Rodriguez Soriano J, Sanjad SA, Tasic V, Taylor CM,Topaloglu R, Smith AN, Karet FE. Novel ATP6V1B1 and ATP6V0A4mutations in autosomal recessive distal renal tubular acidosis with newevidence for hearing loss. J Med Genet 39: 796–803, 2002.

58. Sudhof TC, Fried VA, Stone DK, Johnston PA, Xie XS. Humanendomembrane H� pump strongly resembles the ATP-synthetase ofArchaebacteria. Proc Natl Acad Sci USA 86: 6067–6071, 1989.

59. Sun-Wada GH, Murata Y, Namba M, Yamamoto A, Wada Y, FutaiM. Mouse proton pump ATPase C subunit isoforms (C2-a and C2-b)specifically expressed in kidney and lung. J Biol Chem 278: 44843–44851, 2003.

60. Sun-Wada GH, Yoshimizu T, Imai-Senga Y, Wada Y, Futai M.Diversity of mouse proton-translocating ATPase: presence of multipleisoforms of the C, d and G subunits. Gene 302: 147–153, 2003.

61. Thomas JA, Buchsbaum RN, Zimniak A, Racker E. Intracellular pHmeasurements in Ehrlich ascites tumor cells utilizing spectroscopic probesgenerated in situ. Biochemistry 18: 2210–2218, 1979.

62. van Hoek AN, Ma T, Yang B, Verkman AS, Brown D. Aquaporin-4 isexpressed in basolateral membranes of proximal tubule S3 segments inmouse kidney. Am J Physiol Renal Physiol 278: F310–F316, 2000.

63. van Hoek AN, Yang B, Kirmiz S, Brown D. Freeze-fracture analysis ofplasma membranes of CHO cells stably expressing aquaporins 1–5. JMembr Biol 165: 243–254, 1998.

64. Wagner CA, Finberg KE, Breton S, Marshansky V, Brown D, GeibelJP. Renal vacuolar-ATPase. Physiol Rev 84: 1263–1314, 2004.

65. Wagner CA, Lukewille U, Valles P, Breton S, Brown D, Giebisch GH,Geibel JP. A rapid enzymatic method for the isolation of defined kidneytubule fragments from mouse. Pflügers Arch 446: 623–632, 2003.

66. Winter C, Schulz N, Giebisch G, Geibel JP, Wagner CA. Nongenomicstimulation of vacuolar H�-ATPases in intercalated renal tubule cells byaldosterone. Proc Natl Acad Sci USA 101: 2636–2641, 2004.

67. Yang Q, Li G, Singh SK, Alexander EA, Schwartz JH. VacuolarH�-ATPase B1 subunit mutations that cause inherited distal renal tubularacidosis affect proton pump assembly and trafficking in inner medullarycollecting duct cells. J Am Soc Nephrol 17: 1858–1866, 2006.

68. Zhang J, Vasilyeva E, Feng Y, Forgac M. Inhibition and labeling of thecoated vesicle V-ATPase by 2-azido-[32P]ATP. J Biol Chem 270: 15494–15500, 1995.



on March 19, 2009


ownloaded from

Date post:	01-Feb-2021
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

University of Zurich Zurich Open … · 2010. 11. 29. · Address for reprint requests and other...

Documents